Free Access The autolysin Ami contributes to the adhesion of Listeria monocytogenes to eukaryotic cells via its cell wall anchor Eliane Milohanic, Laboratoire de Microbiologie, Institut National de la Santé et de la Recherche Médicale U 411, Faculté de Médecine Necker-Enfants Malades, 75730 Paris Cedex 15, France.Search for more papers by this authorRenaud Jonquières, Unité des Interactions Bactéries–Cellules, Institut Pasteur, 75724 Paris Cedex 15, France.Search for more papers by this authorPascale Cossart, Unité des Interactions Bactéries–Cellules, Institut Pasteur, 75724 Paris Cedex 15, France.Search for more papers by this authorPatrick Berche, Laboratoire de Microbiologie, Institut National de la Santé et de la Recherche Médicale U 411, Faculté de Médecine Necker-Enfants Malades, 75730 Paris Cedex 15, France.Search for more papers by this authorJean-Louis Gaillard, Corresponding Author Laboratoire de Microbiologie, Institut National de la Santé et de la Recherche Médicale U 411, Faculté de Médecine Necker-Enfants Malades, 75730 Paris Cedex 15, France. Laboratoire de Microbiologie, Faculté de Médecine Paris-Ouest, Hôpital Raymond Poincaré, 104 boulevard Raymond Poincaré, 92380 Garches, France.*For correspondence at the Garches address. E-mail jean-louis.gaillard@rpc.ap-hop-paris.fr; Tel. (+33) 1 47 10 79 50; Fax (+33) 1 47 10 79 49.Search for more papers by this author Eliane Milohanic, Laboratoire de Microbiologie, Institut National de la Santé et de la Recherche Médicale U 411, Faculté de Médecine Necker-Enfants Malades, 75730 Paris Cedex 15, France.Search for more papers by this authorRenaud Jonquières, Unité des Interactions Bactéries–Cellules, Institut Pasteur, 75724 Paris Cedex 15, France.Search for more papers by this authorPascale Cossart, Unité des Interactions Bactéries–Cellules, Institut Pasteur, 75724 Paris Cedex 15, France.Search for more papers by this authorPatrick Berche, Laboratoire de Microbiologie, Institut National de la Santé et de la Recherche Médicale U 411, Faculté de Médecine Necker-Enfants Malades, 75730 Paris Cedex 15, France.Search for more papers by this authorJean-Louis Gaillard, Corresponding Author Laboratoire de Microbiologie, Institut National de la Santé et de la Recherche Médicale U 411, Faculté de Médecine Necker-Enfants Malades, 75730 Paris Cedex 15, France. Laboratoire de Microbiologie, Faculté de Médecine Paris-Ouest, Hôpital Raymond Poincaré, 104 boulevard Raymond Poincaré, 92380 Garches, France.*For correspondence at the Garches address. E-mail jean-louis.gaillard@rpc.ap-hop-paris.fr; Tel. (+33) 1 47 10 79 50; Fax (+33) 1 47 10 79 49.Search for more papers by this author Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URLShare a linkShare onEmailFacebookTwitterLinked InRedditWechat Abstract Adherence of pathogenic microorganisms to the cell surface is a key event during infection. We have previously reported the characterization of Listeria monocytogenes transposon mutants defective in adhesion to eukaryotic cells. One of these mutants had lost the ability to produce Ami, a 102 kDa autolytic amidase with an N-terminal catalytic domain and a C-terminal cell wall-anchoring domain made up of repeated modules containing the dipeptide GW (‘GW modules’). We generated ami null mutations by plasmid insertion into L. monocytogenes strains lacking the invasion proteins InlA (EGDΔinlA), InlB (EGDΔinlB) or both (EGDΔinlAB). These mutants were 5–10 times less adherent than their parental strains in various cell types. The adhesion capacity of the mutants was restored by complementation with a DNA fragment encoding the Ami cell wall-anchoring domain fused to the Ami signal peptide. The cell-binding activity of the Ami cell wall-anchoring domain was further demonstrated using the purified polypeptide. Growth of the ami null mutants constructed in EGD and EGDΔinlAB backgrounds was attenuated in the livers of mice inoculated intravenously, indicating a role for Ami in L. monocytogenes virulence. Adhesive properties have recently been reported in the non-catalytic domain of two other autolysins, Staphylococcus epidermidis AtlE and Staphylococcus saprophyticus Aas. Interestingly, we found that these domains were also composed of repeated GW modules. Thus, certain autolysins appear to promote bacterial attachment by means of their GW repeat domains. These molecules may contribute to the colonization of host tissues by Gram-positive bacteria. Introduction Bacterial autolysins are endogenous enzymes that can break covalent bonds in the peptidoglycan of their own cell walls (Ghuysen etal., 1966). These molecules have been implicated in various biological functions, such as cell wall turnover, cell separation, cell division and antibiotic-induced autolysis (Ward and Williamson, 1984; Shockman and Höltje, 1994). There is also evidence that autolysins contribute to the pathogenicity of Gram-positive bacteria. Intact autolytic function is required for full expression of virulence in Streptococcus pneumoniae (Berry etal., 1989). It has been suggested that pneumococcal autolysins facilitate the release of potent pro-inflammatory agents such as cell wall components or toxins (Diaz etal., 1992; Canvin etal., 1995). The main pneumococcal toxin, pneumolysin, is located in the cytoplasm and is released when bacterial cells undergo autolysis (Johnson, 1977; Berry etal., 1989). This might result in the killing of inflammatory cells and major tissue damage. Autolysis-defective mutants of Staphylococcus aureus have attenuated virulence in models of endocarditis (Mani etal., 1994). The staphylococcal glucosaminidase alters the host immune response by inhibiting the response of human lymphocytes to mitogens and by interfering with the production of antibodies in mice (Valisena etal., 1991). The p60 protein produced by Listeria monocytogenes has autolytic properties and may play a role in invasivity and virulence (Wuenscher etal., 1993). Recent data suggest that certain autolysins may contribute directly to the pathogenicity of Gram-positive bacteria by mediating bacterial adherence. A wild-type DNA fragment complementing Tn917 insertion mutants in Staphylococcus epidermidis affected in initial attachment to polystyrene was cloned (Heilmann etal., 1996; 1997). The DNA fragment carried an open reading frame (ORF), atlE, encoding a 148 kDa protein similar to the autolysin Atl of S. aureus. In addition to mediating attachment to polystyrene, AtlE has a strong vitronectin-binding activity. Hell etal. (1998) reported the cloning and sequencing of a gene encoding a surface protein of Staphylococcus saprophyticus with haemagglutination and fibronectin-binding activities (Gatermann etal., 1992; Gatermann and Meyer, 1994). This protein, Aas (autolysin/adhesin of S.saprophyticus), is an autolysin similar to Atl and AtlE. AtlE and Aas are composed of two enzymatic domains connected by a central non-catalytic domain. Subcloning experiments mapped the adhesive activities of Aas to the non-catalytic domain (Hell etal., 1998). L. monocytogenes is a ubiquitous Gram-positive, food-borne bacillus responsible for life-threatening infections in humans and animals (Gray and Killinger, 1966; Farber and Peterkin, 1991). It is a facultative intracellular pathogen able to enter and multiply in both professional (Mackaness, 1962) and non-professional phagocytes such as epithelial cells (Gaillard etal., 1987; 1991) or hepatocytes (Wood etal., 1993; Dramsi etal., 1995; Gaillard etal., 1996). The molecular basis of its intracellular lifestyle has largely been elucidated (for a recent review, see Cossart and Lecuit, 1998). After entry, L. monocytogenes rapidly lyses the phagosome and gains access to the cytosol. It then spreads to adjacent cells by an actin-based motility process. Lysis of the phagosome results mainly from listeriolysin O, a sulphydryl-activated haemolysin active at acidic pH. Actin assembly is mediated by the surface protein ActA. Listeriolysin O, ActA and several other factors involved in the escape of bacteria into the cytosol and in intra- and intercellular spread are encoded by a cluster of genes located on a single chromosomal fragment. Their expression is co-ordinately regulated by the transcriptional activator PrfA. The interaction of L. monocytogenes with host cells is a key event in the pathogenesis of listeriosis. This process involves a number of surface proteins, including InlA (internalin), InlB, ActA and p104. InlA and InlB are encoded by homologous genes forming an operon partially controlled by PrfA. InlA is an 800-amino-acid protein required for entry into the human enterocyte-like cell line Caco-2 (Gaillard etal., 1991; Dramsi etal., 1993) and other cell lines expressing its cellular receptor, the adhesion molecule E-cadherin (Mengaud etal., 1996). InlB is a 630-amino-acid protein (Gaillard etal., 1991; Dramsi etal., 1995) required for entry into hepatocytic cell lines and some epithelial cell lines (Dramsi etal., 1995; Braun etal., 1998). Recent data indicate that gC1qR is a eukaryotic ligand of InlB and that this protein probably acts in concert with one or more molecules to mediate InlB-dependent entry (Braun etal., 2000). There is evidence that ActA promotes the attachment of L. monocytogenes to the cell surface through proteoglygans (Alvarez-Dominguez etal., 1997). More recently, Pandiripally etal. (1999) have shown the involvement of a cell surface protein of 104 kDa (p104) in the adhesion of L. monocytogenes to the human intestinal cell line Caco-2. Ami is an autolytic amidase recently identified in L. monocytogenes by two different approaches. The ami gene was identified by Southern blotting of L. monocytogenes EGD chromosomal DNA using the 3′ end of the inlB gene as a probe (Braun etal., 1997) and by screening an expression library for clones producing lytic enzymes (McLaughlan and Foster, 1998). Ami of EGD is a 917-amino-acid protein with three characteristic domains: (i) a 30-amino-acid putative signal sequence; (ii) a 179-amino-acid N-terminal domain similar to the alanine amidase domain of the Atl autolysin of S. aureus; (iii) a C-terminal domain (between amino acids 262 and 917) made up of four repeats of approximately 160 amino acids; each repeat can be divided into two modules containing the dipeptide GW (‘GW modules’), module 1 consisting of 82–83 amino acids and module 2 of 78 amino acids (Braun etal., 1997). The C-terminal region of Ami is homologous to the C-terminal cell wall-anchoring domain of InlB, which is made up of three GW modules (Braun etal., 1997). In contrast to InlB, which is partially released in culture supernatants, Ami is detected exclusively on the bacterial surface. A hybrid protein comprising the N-terminal part of InlB and the eight GW modules of Ami is also totally retained at the surface (Braun etal., 1997). It has been suggested that the larger number of GW repeats in Ami may anchor the molecules more efficiently to the bacterial cell wall (Braun etal., 1997; Jonquières etal., 1999). We recently characterized adhesion-defective transposon insertion mutants obtained in an inlAB background (Milohanic etal., 2000). The mutant that was most severely affected for adhesion had lost the ability to produce Ami. This suggested that this molecule might be involved in adhesion. We present evidence here that Ami plays a direct role in the adhesion of L. monocytogenes to eukaryotic cells via its cell wall-binding domain. The ami gene was inactivated by plasmid insertion in EGD, EGDΔinlA, EGDΔinlB and EGDΔinlAB strains. The gene immediately downstream from ami, pyrG, is transcribed convergently to it (Braun etal., 1997; McLaughlan and Foster, 1998). Thus, insertional events in ami were unlikely to have a polar effect. Abrogation of Ami expression was confirmed by analysing 1% SDS extracts, which are representative of surface protein extracts (Tabouret etal., 1992), by Western blotting using anti-Ami serum. The band at ≈ 100 kDa corresponding to the complete form of Ami (McLaughlan and Foster, 1998) was detected in extracts of parental strains, but not in those of mutants (Fig. 1). Irrespective of the genetic background in which they were constructed, the ami mutants appeared to divide normally over a range of temperatures (20°C, 25°C, 30°C, 37°C and 42°C). Similar results have been reported in previous studies (McLaughlan and Foster, 1998). It is probable that other autolysins may have a compensatory role in cell division, as shown in Bacillus subtilis (Blackman etal., 1998). Abrogation of Ami expression in ami null mutants generated by plasmid insertion. Western blots of 1% SDS bacterial extracts from EGD (lane 1), EGD ami (lane 2), EGDΔinlA (lane 3), EGDΔinlA ami (lane 4), EGDΔinlB (lane 5), EGDΔinlB ami (lane 6), EGDΔinlAB (lane 7) and EGDΔinlAB ami (lane 8) were probed with affinity-purified anti-Ami polyclonal antibodies. The complete form of Ami at ≈ 100 kDa is clearly lacking in cell extracts from ami null mutants. The adhesion capacities of the ami mutants to eukaryotic cells were studied in various cell assay systems after a 1 h incubation at an initial ratio of 100 bacteria cell−1 (Fig. 2). The ami mutant in the wild-type EGD background adhered normally to all cell types tested except for Hep-G2 cells. In contrast, the mutants in EGDΔinlA, EGDΔinlB and EGDΔinlAB backgrounds were 5–10 times less adherent than their parental strains. The largest effect was in the EGDΔinlAB and EGDΔinlB backgrounds with SK-MEL 28 and Hep-G2 cells. Similar results were obtained with various multiplicities of infection (MOIs; 10–500 cfu cell−1) and incubation times (15 min to 3 h) and with bacteria grown to exponential, late exponential and stationary phases (not shown). The ami mutants were not significantly impaired in cell invasion (not shown). They also replicated normally inside cells and retained the ability to induce actin assembly (not shown). Thus, although interacting less efficiently with the cell surface, the ami mutants in EGDΔinlA, EGDΔinlB and EGDΔinlAB backgrounds fully retained the ability to trigger their uptake by cells. Adhesion of ami mutants to eukaryotic cells. Cells were incubated for 1 h at 37°C with ≈ 100 bacteria per cell, washed and processed for fluorescence immunolabelling of bacteria. Results are expressed as the mean (SD) number of adherent bacteria cell−1 (SK-MEL 28) or cell islet−1 (Caco-2, HepG-2) (three determinations). The asterisk indicates differences that are statistically significant (P 0.05). The cell wall-anchoring domain of Ami is sufficient to restore the adhesion capacity of ami mutants Complementation experiments were performed to confirm the role of ami in adhesion and to determine which region of the molecule was involved. The central non-catalytic domain of the staphylococcal autolysin, Aas, has been shown to be sufficient for expression of the adhesive properties of the molecule (Hell etal., 1998). Moreover, attempts to clone the whole ami gene have been reported to be unsuccessful (Braun etal., 1997; McLaughlan and Foster, 1998). We therefore examined directly whether the DNA fragment encoding the cell wall-anchoring domain of Ami could complement the ami mutants for adhesion to cells. We constructed a plasmid expressing the cell wall-anchoring domain of Ami (Amicwa) fused to its signal sequence under the control of the L. monocytogenes promoter PdltA. This plasmid, pEL13-B, was introduced by electroporation into the mutants EGD ami and EGDΔinlAB ami. We first studied the expression of Amicwa and its localization in recipient strains by SDS–PAGE and Western blotting analysis using anti-Ami serum. The Amicwa polypeptide (about 75 kDa) was found in total-cell extracts, but not in culture supernatants (not shown). It was also detected in 1% SDS extracts (Fig. 3). Immunofluorescence staining showed that Amicwa was exposed at the surface of bacterial cells, as reported previously for Ami (Braun etal., 1997). Production of the Amicwa polypeptide in complemented strains. SDS bacterial extracts from EGD (lane 1), EGD ami (pAT28) (lane 2), EGD ami (pEL13-B) (lane 3), EGDΔinlAB (lane 4), EGDΔinlAB ami (pAT28) (lane 5) and EGDΔinlAB ami (pEL13-B) (lane 6) were subjected to electrophoresis in a 10% polyacrylamide gel and silver stained. Arrowheads indicate the positions of the unprocessed form of Ami at 100 kDa, of the Amicwa polypeptide at 75 kDa and of InlB at 65 kDa. The positions of molecular mass standards run on the same gel are indicated on the left. Note the large amounts of the Amicwa polypeptide in strains harbouring pEL13-B. Adhesion assays for complemented strains are shown in Table 1 and illustrated in Fig. 4. In all cell systems, the expression of Amicwa restored the adhesion capacity of the EGDΔinlAB ami mutant. Despite the production of large amounts of Amicwa (Fig. 3), the adhesion capacity of bacteria did not exceed that of EGDΔinlAB (wild-type for ami). This may suggest that only a proportion of Amicwa was properly exposed at the bacterial surface, so that it could interact with eukaryotic cells. Alternatively, the adhesion of bacteria to eukaryotic cells may be a saturable process. In agreement with this hypothesis, overexpression of Amicwa in the EGD background had no significant effect on adhesion. Table 1. Adhesion of ami null mutants complemented with the ami cell wall-anchoring region. Strains were assayed for adhesion as described in the legend to Fig. 1. Results are expressed as the mean (SD) number of adherent bacteria cell−1 (SK-MEL28) or cell islet−1 (Caco-2, Hep-G2). Restoration of adhesiveness to EGDΔinlAB ami null mutants expressing the Amicwa polypeptide. A. EGDΔinlAB. B. EGDΔinlAB ami (pAT28). C. EGDΔinlAB ami (pEL13-B). The adhesion of Listeria to SK-MEL 28 cells is shown. Experimental conditions are as described in legend to Fig. 2. Note that both EGDΔinlAB and EGDΔinlAB ami (pEL13-B) interact preferentially with the periphery of SK-MEL 28 cells. It is also shown that EGDΔinlAB ami (pEL13-B) does not adhere to the plastic surface. Effect of the overexpression of the cell wall-anchoring domain of Ami on cell invasion EGD ami and EGDΔinlAB ami strains harbouring pEL13-B were tested for cell invasion using a gentamicin survival assay (Fig. 5). The expression of Amicwa had no significant effect on entry into the SK-MEL 28 and Caco-2 cell lines; in contrast, it resulted in an ≈ fivefold reduction in bacterial entry into the Hep-G2 cell line in both EGD ami and EGDΔinlAB ami backgrounds. Intracellular growth rates of complemented and non-complemented bacteria were comparable. Invasiveness of ami null mutants overexpressing the cell wall-anchoring domain of Ami. Cell monolayers were incubated for 1 h at 37°C with ≈ 100 bacteria cell−1. After washing, the cells were reincubated for 8 h in fresh culture medium containing gentamicin (10 mg l−1). At intervals, the cells were washed again, lysed and viable bacteria counted on agar plates. Data points and error bars represent the mean and SD of the number of bacteria well−1 (three determinations). Thus, surprisingly, overexpression of Amicwa appears to inhibit the entry of Listeria into Hep-G2 cells, but not into SK-MEL 28 and Caco-2 cells. This may suggest that this polypeptide binds to Hep-G2 cells with a particular efficiency (see below). The mechanism whereby Amicwa interferes with entry into Hep-G2 cells is unknown. Overexpression of Amicwa may hinder the entry process by promoting a too strong association of bacteria to the cell surface. We tested whether Amicwa could bind eukaryotic cells directly. Microtitre plates were coated with various amounts of purified Amicwa and incubated with either Caco-2 or Hep-G2 cells for 1 h at 37°C. Cell binding was evaluated using a hexosaminidase colorimetric assay (Fig. 6). Purification and cell-binding assay of recombinant protein Amicwa. A. Amicwa6xHis was purified by metal affinity chromatography followed by cation exchange chromatography (see Experimental procedures). Five micrograms of the purified Amicwa (1) or Amicwa6xHis (2) were analysed by SDS–PAGE 8%. The gel was stained with Coomassie blue. B. Cell-binding activity of purified Amicwa. Wells coated with purified Amicwa or BSA at various concentrations were incubated with Caco-2 or Hep-G2 cells for 1 h at 37°C. After washing, bound cells were quantified by a colorimetric hexosaminidase assay. Values are given relative to the binding value obtained with poly l-lysine-coated wells, fixed arbitrarily at 100 (mean and SD for three independent experiments). Purified Amicwa was clearly able to bind both Caco-2 and Hep-G2 cells in a dose-dependent manner, whereas purified BSA did not bind cells significantly. Binding efficiencies were approximately 10 times greater with Hep-G2 cells than with Caco-2 cells, irrespective of the amount of coated Amicwa. These findings suggest that Amicwa binds directly to eukaryotic cells with an efficiency that differs between cell lines. Protein and nucleotide databases were searched using the Ami sequence. The only significant similarities were found with the staphylococcal autolysins, Atl, AtlE and Aas (Fig. 7). Similarities were highest between the amidase domains of the molecules (amino acid identity ranging from 41.1% to 44.9% over 214- to 236-amino-acid overlaps). However, similarities were also seen between the C-terminal cell wall-anchoring domain of Ami and the central cell wall-anchoring domains of Atl, AtlE and Aas, with levels of amino acid identity from 11.8% to 20.9% (over 99- to 171-amino-acid overlaps). The Listeria and Staphylococcus autolysins with repeated GW modules: Ami, Atl, AtlE and Aas. A. General organization of Ami, Atl, AtlE and Aas. Ami is a monofunctional protein with alanine amidase activity. The staphylococcal autolysins, Atl, AtlE and Aas, are bifunctional proteins that are cleaved at the bacterial surface to generate separated alanine amidase and glucosaminidase hydrolases. Unlike Atl and AtlE, Aas possesses seven highly similar, contiguous N-terminal repeats whose function is unknown. Ami, Atl, AtlE and Aas each possesses a cell wall-anchoring domain made up of repeats. Ami has four repeats at its C-terminus. Unprocessed Atl, AtlE and Aas each have a central domain containing three repeats (repeat R2 is truncated in Aas); cleavage into separated enzymes is such that R1 and R2 are linked to the C-terminus of amidase, whereas R3 is located at the N-terminus of glucosaminidase. S, signal sequence; PP, propeptide; AA, alanine amidase; GL, glucosaminidase; CWA, cell wall-anchoring; Rn, repeats. B. Aligned sequences of the repeated GW modules of each Ami, Atl, AtlE and Aas. Hyphens represent gaps introduced to maximize matching. Amino acids that are identical between the repeated GW modules of each molecule are shaded. The consensus sequences (con) show the amino acids identical in at least five out of eight modules (Ami), four out of six modules (Atl and AtlE) and three out of five modules (Aas). M1-Rn, module 1 of repeat Rn; M2-Rn, module 2 of repeat Rn. The sequence data were taken from Braun etal., 1997 (Ami), Oshida etal., 1995 (Atl), Heilmann etal., 1997 (AtlE) and Hell etal. (1998) (Aas). The central cell wall-anchoring domains of Atl, AtlE and Aas contain homologous, contiguous repeats: three repeats of ≈ 170 amino acids in Atl and AtlE (R1, R2 and R3); one complete repeat of 163 amino acids (R1) and two truncated repeats of 99 (R2) and 149 (R3) amino acids in Aas (Fig. 7) (Oshida etal., 1995; Heilmann etal., 1997; Hell etal., 1998). Repeat R1 of each molecule is connected to the amidase domain by a stretch of 15–20 amino acids starting with the sequence LIXEKY, which is also present at the same location in Ami (not shown). Interestingly, all the repeats of the anchoring domains of Atl, AtlE and Aas are made of two GW modules. As found in Ami, the dipeptide GW in both modules is more often followed by valine (V). There are few other conserved residues between the GW modules of Ami and staphylococcal autolysins, as shown in Fig. 7, where alignment of GW modules is slightly modified from Braun et al. (1997). The virulence of EGD ami and EGDΔinlAB ami was studied in mice. The intravenous LD50s of EGD and its ami mutant differed reproducibly (105.1 versus 105.9), whereas there was a small difference between EGDΔinlAB and its ami mutant (106.4 versus 106.7). Kinetics of bacterial survival were followed in liver and spleen after intravenous injection of ≈ 0.1 × LD50 (Fig. 8). EGD ami and EGDΔinlAB ami appeared to be attenuated in the liver; however, consistent with the results of LD50s, differences were only statistically significant in the EGD background (Fig. 8). There was no significant effect of ami mutations on the growth of bacteria in the spleen. Strains complemented with amicwain trans could not be meaningfully assayed for virulence in mice because of the rapid loss of pEL13-B during the course of infection. Growth of ami null mutants in the liver and spleen of mice after intravenous challenge. Mice were infected by intravenous injection of ≈ 0.1 × LD50 (EGD derivatives, 104 bacteria; EGDΔinlAB derivatives, 105 bacteria). Bacterial growth was followed in liver and spleen by killing of mice at intervals. Data points and error bars represent the mean and SD of the log10 bacteria per organ (mean of four mice for each point). The numbers of bacteria in liver differed significantly for EGD and EGD ami on day 3 (P = 0.0015). We provide evidence that Ami mediates the adhesion of L. monocytogenes to eukaryotic cells via its cell wall-anchoring domain. Inactivation of ami leads to a severe loss of adhesion, as reported previously (Milohanic etal., 2000). However, this effect can only be demonstrated in inlA and/or inlB mutant genetic backgrounds. Indeed, InlA (internalin) and InlB also act as adhesins (for a review, see Ireton and Cossart, 1997) and are probably able to overcome the defect in Ami cell adhesion function. Ami is clearly exposed at the surface of bacterial cells, a prerequisite for its function as an adhesin (Braun etal., 1997). However, this molecule is particularly abundant at the bacterial septum (Braun etal., 1997). Thus, the adhesion promoted by Ami may involve a very limited part of the bacterial cell surface, and this might explain why this process is masked in strains expressing InlA and InlB. We demonstrated by two different approaches that the adhesion functions of Ami map to its cell wall-anchoring domain. The expression of this domain by complementation restored the adhesion capacity of the ami null mutants in inlA and/or inlB backgrounds. Moreover, eukaryotic cells bound significantly to the purified Ami cell wall-anchoring domain. This experiment provided a direct demonstration that the cell wall-anchoring domain of a bacterial autolysin is implicated in adhesion. It is the first example of an autolysin with adhesive properties produced by an intracellular pathogen. The eukaryotic cell receptor or receptors recognized by Ami remain to be determined. The purified cell wall-anchoring domain of Ami was found to bind eukaryotic cells with an efficiency that differed between cell lines. This may suggest that Ami binds to receptor molecules that are variably expressed by eukaryotic cells. This issue warrants further studies with a larger panel of cell lines. The role of Ami in Listeria adhesion is consistent with recent studies showing that the staphylococcal autolysins, AtlE and Aas, have adhesive properties (Heilmann etal., 1997; Hell etal., 1998). Like Ami, the non-catalytic cell wall-anchoring domains of both AtlE and Aas carry the adhesive properties of the molecules. Experiments using different His-tag purified protein fragments of Aas have shown that the fragment corresponding to the whole non-catalytic domain, displayed here as the GW repeats (R1–R3), had the strongest adhesion activity. Adhesion activity was also observed, although to a lesser extent, with fragments limited to repeats R1 or R3 of this domain. In contrast, the fragments from the catalytic domains alone did not show significant adhesion activity. Consistent with these data, Heilmann etal. (1997) reported that adhesion activity was strong with the unprocessed form of AtlE, which has three repeats, and weaker with the amidase and glucosaminidase processing products, which only have two and one repeats respectively (Hell etal., 1998). The cell wall-anchoring domains of autolysins have an essential function in targeting the catalytic domains to designated sites on the bacterial surface, therefore allowing localized peptidoglycan hydrolysis (Kuroda etal., 1992; Navarre and Schneewind, 1999). This has been studied most extensively for Atl. Atl is a bifunctional protein that has an amidase domain and an endo-β-N-acetylglucosaminidase domain separated by a non-catalytic central domain made up of three repeats (R1, R2 and R3; Fig. 7) (Oshida etal., 1995). It is secreted as a proenzyme (pro-Atl), which is directed to the cell surface and cleaved to generate mature amidase (62 kDa) and glucosaminidase (51 kDa). Pro-Atl cleavage is such that R1 and R2 are linked to the C-terminus of amidase, whereas R3 is located at the N-terminus of glucosaminidase (Oshida etal., 1995). Pro-Atl, amidase and glucosaminidase are found localized to the equatorial ring on the staphylococcal cell surface that marks the future cell division site (Yamada etal., 1996). A recent study has shown that the repeats (R1, R2 and R3) were each sufficient to direct reporter proteins to the equatorial surface ring (Baba and Schneewind, 1998). Baba and Schneewind (1998) have postulated the existence of a specific receptor that is positioned or particularly abundant at sites of cell division. This receptor might be lipoteichoic acid (Fisher, 1994). This is consistent with immunoelectron microscopy data showing the association of Atl products with fibrous material extending from the staphylococcal cell membrane (Yamada etal., 1996). GW repeat domains are present in a growing family of surface proteins produced by Gram-positive bacteria, including L. monocytogenes InlB and Ami (Braun etal., 1997) and the staphylococcal autolysins Atl, AtlE and Aas (this study). These proteins are likely to use a common anchoring process involving the interaction of repeated GW modules with cell wall polymers such as teichoic acids or lipoteichoic acids. A recent study suggests that the GW repeat domain of Ami could promote attachment of the molecule to the bacterial surface by interacting with lipoteichoic acid (Jonquières etal., 1999). Similar anchoring mechanisms have been described in S. pneumoniae, in which several proteins bind to the choline residues of both teichoic acids and lipoteichoic acids (Yother and White, 1994; Rosenow etal., 1997). These choline-binding proteins include LytA, a major autolysin, and PspA, a major antigen produced during animal infection by S. pneumoniae. Interestingly, the cell wall-anchoring domains of LytA and PspA are also made up of repeated modules containing the dipeptide GW. However, in these proteins, each module consists of only about 20 amino acids. Thus, L. monocytogenes and some staphylococcal species appear to use the GW repeat domains of their autolysins to promote bacterial attachment to cells or cell matrix. A key question is whether this process is specific. The totally distinct adhesion specificities of AtlE and Aas favour this view. AtlE plays a role in the attachment of bacterial cells to a polystyrene surface (Heilmann etal., 1997). It also has a strong vitronectin-binding activity, but no significant fibronectin-binding activity. In contrast, Aas, which mediates haemagglutination, binds fibronectin but does not bind vitronectin (Hell etal., 1998). Thus, autolysins with adhesive functions might enable bacterial pathogens to colonize particular ecological niches. This is consistent with the fact that cell wall-anchoring domains are not conserved between the various molecules described so far, probably because they recognize different cell surface targets (Navarre and Schneewind, 1999). The significance of autolysins being adhesins is unclear. It has been suggested that the presence of adhesive functions and autolytic activity in one molecule may contribute to conservation of the adhesin, as the loss of the gene would greatly impair the viability of the bacterial cell (Hell etal., 1998). The same situation is found with the p60 protein produced by L. monocytogenes, which has autolytic properties and plays a role in the invasion of cells. Mutants producing low levels of p60 are weakly invasive, whereas the complete loss of p60 is lethal (Kuhn and Goebel, 1989). Linking adhesive and autolytic activity might also be advantageous in enabling the bacteria to modulate the colonization of host tissues in accordance with their metabolic state. This might result in selecting those individuals best adapted to a given ecological niche in a clonal population. A more appealing idea is that autolysins may not have acquired adhesive properties in some pathogenic bacteria, but that some pathogenic bacteria may have arisen among bacteria expressing autolysins with adhesive properties. In this scenario, autolysins/adhesins would have been primitive colonizing factors allowing bacteria to interact with surfaces expressing molecules analogous to their natural receptors (i.e. analogous to their teichoic or lipoteichoic acids). The ami mutants were attenuated in the liver of mice inoculated intravenously, indicating a reduced capacity of bacteria to colonize this organ. Thus, Ami appears to play a direct role in the virulence of L. monocytogenes by promoting the infection of host tissues. By analogy, the autolysins, AtlE and Aas, may also be virulence factors per se through their function as adhesins. These findings challenge the common belief that autolysins contribute only indirectly to the pathogenicity of bacteria by facilitating the release of immunologically active cell wall components or toxins (Diaz etal., 1992; Canvin etal., 1995). It would be interesting to reconsider the role of autolysins in bacterial pathogenesis in view of these new data. The bacterial strains and plasmids used in this study are listed in Table 2. Brain–heart infusion (BHI; Difco Laboratories) and Luria–Bertani (LB; Difco Laboratories) broth and agar were used to grow Listeria and Escherichia coli strains respectively. Strains harbouring plasmids were grown in the presence of the following antibiotics: pUC derivatives, ampicillin 100 mg l−1; pAUL-A derivatives, erythromycin 150 mg l−1 (E. coli) and 5 mg l−1 (L. monocytogenes); pAT28 derivatives, spectinomycin 60 mg l−1; pET28a+ derivatives, kanamycin 50 mg l−1. The human melanoma cell line SK-MEL 28 (ATCC HTB 72), obtained from R. Gabathuler and W. A. Jefferies (University of British Columbia, Vancouver, Canada), was used between passages 20 and 40. This cell line was cultured in Dulbecco\'s modified Eagle medium (DMEM, 25 mM glucose; Gibco Laboratories), supplemented with 10% fetal bovine serum (FBS; Gibco), 20 mM HEPES and 2 mM l-glutamine (Gibco). The human colon carcinoma cell line Caco-2 (ATCC HTB 37), used between passages 25 and 35, was propagated as described previously (Gaillard and Finlay, 1996). The human hepatocellular carcinoma cell line Hep-G2 (ATCC HB 8065) was propagated as described by Dramsi etal. (1995). All incubations were carried out in a 10% CO2 atmosphere at 37°C. For the assays, cells were seeded at 8 × 104 cells cm−2 onto 12-mm-diameter glass coverslips in 24-well plates (adhesion assays) or in 24-well tissue culture plates (Falcon; Becton Dickinson) (invasion assays). Monolayers were used 24 h (SK-MEL 28) or 48 h (CaCo-2 and Hep-G2) after seeding. Bacteria from 18 h cultures in BHI broth were pelleted by centrifugation, washed once and diluted appropriately in DMEM. Cells were inoculated at an MOI of ≈ 100 bacteria cell−1. After 1 h of incubation, they were washed three times with PBS, fixed with 3% paraformaldehyde (w/v in PBS) for 30 min and washed three times again with PBS before being processed for fluorescence labelling. For immunolabelling of listeriae, cells were incubated sequentially with a rabbit antiserum to listerial O antigen 1/2 (J. Rocourt, Institut Pasteur, Paris, France), diluted 1:1000, and a CY3-labelled goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories), diluted 1:1000. Dilutions were made in 1% BSA-PBS. Incubations were carried out for 30 min at room temperature and followed by three washes in PBS. Coverslips were mounted on slides and examined by fluorescence microscopy with a Leica DMRB microscope. Each assay was carried out in triplicate and repeated three times. Adherent bacteria were counted by examining 500 cells in randomly picked microscopic fields. Cells were inoculated at an MOI of ≈ 100 bacteria cell−1, as described above. After 1 h of incubation to allow bacterial entry, cells were washed twice and overlaid with fresh DMEM containing gentamicin (10 mg l−1) to kill extracellular bacteria. At intervals, cells were washed twice and processed for either bacterial counting or F-actin staining. For bacterial counting, cells were lysed by adding cold distilled water. The titre of viable bacteria released from the cells was determined on agar plates. Each experiment was carried out in triplicate and repeated three times. For F-actin staining, cells were fixed with 3% paraformaldehyde, washed three times, permeabilized for 5 min in 0.1% Triton X-100 (Sigma) in PBS and stained by rhodamine–phalloidin (Molecular Probes) as described previously (Gaillard and Finlay, 1996). Proteins from total bacterial extracts and culture supernatants were prepared as follows. Aliquots (1 ml) of bacterial cultures at an OD600 of 0.6 were centrifuged. The resulting pellets were washed twice in cold water and sonicated three times for 5 min. Lysates were collected by centrifugation and suspended in 1 × SDS–PAGE sample buffer (130 mM Tris-HCl, pH 6.8, 1% SDS, 7% 2-β-mercaptoethanol, 7% sucrose, 0.01% bromophenol blue). Proteins were precipitated from culture supernatants by the addition of 10% trichloroacetic acid. Precipitates were washed twice with cold acetone and suspended in 1 × SDS–PAGE sample buffer. For preparation of 1% SDS extracts, bacterial pellets from 10 ml cultures were washed twice in PBS and suspended in 0.2 ml of PBS containing 1% SDS. The bacterial cells were incubated for 15 min at 37°C. Supernatants collected after centrifugation were passed through a 0.22 µm filter (Millipore) and treated as described above. SDS–PAGE was carried out as described previously (Laemmli, 1970) in 10% polyacrylamide minigels (Mini Protean II; Bio-Rad). Proteins were stained with Coomassie brilliant blue or by silver staining (Silver Stain Plus; Bio-Rad). Western blotting was carried out as described previously (Gholizadeh etal., 1997). Western blots were probed with rabbit affinity-purified anti-Ami antibody or rabbit anti-InlB antibody (Braun etal., 1997), diluted 1:1000, and anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody. Antibody binding was revealed by adding 0.05% diaminobenzidine-tetrahydrochloride (Sigma) and 0.03% hydrogen peroxide. Total DNA from Listeria cells was prepared as described previously (Poyart-Salmeron etal., 1992). Plasmid DNA from E. coli was prepared by rapid alkaline lysis (Birnboim and Doly, 1979). Standard techniques were used for DNA fragment isolation, DNA cloning and restriction analysis (Sambrook etal., 1989). Restriction enzymes and ligase were purchased from New England Biolabs and used as recommended by the manufacturer. DNA was amplified with Taq DNA polymerase (Promega) or Vent DNA polymerase (New England Biolabs) for 35 cycles of 60 s at 95°C, 60 s at 55°C and 90 s at 72°C in a Gene Amp System 9600 thermal cycler (Perkin-Elmer). Nucleotide sequencing was carried out with Taq DiDeoxy terminators and by the DyePrimer Cycling Sequence protocol developed by Applied Biosystems (Perkin-Elmer) with fluorescently labelled dideoxynucleotides and primers respectively. Fluorescently labelled primers were purchased from Life Technologies. Labelled extension products were analysed on an ABI Prism 310 apparatus (Applied Biosystems, Perkin-Elmer). Protein and nucleotide databases were searched using the programs blastn and blastx (National Center for Biotechnology Information, Los Alamos, NM, USA), available via the Internet. Protein sequences were aligned by the program clustal V. A 495 bp ami fragment (positions 524–1018; Braun etal., 1997) was amplified by polymerase chain reaction (PCR) from EGDΔinlAB genomic DNA using the primers 5′-(CG) GAATTCGCGTACTACAGCAAGTCCC-3′ and 5′-(CCC)AA GCTTCTGCATCATGTGACCAGAC-3′, which contain EcoRI and HindIII sites respectively (underlined). After EcoRI and HindIII digestion, the PCR product was cloned into the thermosensitive shuttle vector pAUL-A (Chakraborty etal., 1992). The resulting plasmid, pEL1-A, was introduced into L. monocytogenes strains by electroporation. Transformants were selected on BHI plates containing 5 mg l−1 erythromycin at 30°C. Bacteria were cured of plasmids by subculturing at the non-permissive temperature (42°C). Correct insertional events were confirmed by Southern blotting. A 105 bp fragment encoding the signal sequence of Ami (positions 322–426; Braun etal., 1997) was amplified by PCR from EGDΔinlAB genomic DNA using the primers 5′-(CG)GGATCCGAGGAGAGGATTTAAACTTTGAAAAAATTA G-3′ and 5′-(TGC)TCTAGACGGATCAGTGGAAGCAG-3′, which contain BamHI and XbaI sites respectively (underlined). The resulting fragment was digested with BamHI and XbaI and inserted into vector pAT28, giving rise to pEL1-B. The region encoding the cell wall-anchoring domain of Ami (positions 1105–3100; Braun etal., 1997) was amplified from EGDΔinlAB chromosomal DNA using the primers 5′-(TGC) TCTAGATTGATTAACGAAAAATATAAAGC-3′ and 5′-(CAT) GCATGCAGCCATACCCGGCTGGAG-3′, which introduce XbaI and SphI sites respectively (underlined). The resulting fragment was digested with XbaI and SphI and ligated into pEL1-B, giving rise to pEL3-B. The promoter region of the L. monocytogenes dlt operon was excised from plasmid pNF8 (Fortineau et al., 2000) with EcoRI and BamHI and inserted into pEL3-B. The resulting plasmid, pEL13-B, was introduced into L. monocytogenes strains by conjugation as described previously (Trieu-Cuot etal., 1987). All constructions were verified by sequencing of the inserts and both junctions. A 1995 bp PCR fragment (positions 1105–3100; Braun etal., 1997) was produced using genomic DNA of EGDΔinlAB as the template and the primers 5′-(CTA)GCTAGCTTGAT TAACGA AAAATATAAAGC-3′ and 5′-(CGC)GGATCCAGC CATACCC GGCTGGAG-3′, which introduce NheI and BamHI sites (underlined) respectively. The resulting fragment was digested with NheI and BamHI and inserted in frame upstream from the His tag sequence in the expression vector pET28a+ (Novagen). The resulting plasmid, pET28.a-5, was verified by sequencing the insert from both junctions. It was used to transform E. coli BL21(DE3) (Novagen), giving rise to BUG 1756. Recombinant Amicwa6xHis was purified using a two-step chromatographic procedure. The first step of purification by metal affinity chromatography (Novagen) has been detailed elsewhere (Braun etal., 1998). The fractions containing Amicwa6xHis were pooled and subjected to cation exchange chromatography using a 5 ml Hitrap SP column (Pharmacia). The loading buffer was 50 mM HEPES (pH 7.6) and 200 mM NaCl. Elution was performed with a 0.2–0.4 M NaCl gradient. The Amicwa6xHis polypeptide eluted at 280 mM NaCl, was dialysed for 18 h against loading buffer and concentrated using Centriprep 50 devices (Amicon). The His tag was removed by thrombin digestion as described previously (Ireton etal., 1999). The purified Amicwa polypeptide was aliquoted and stored at −80°C. Protein concentrations were determined with the BCA system (Pierce). Maxisorp microtitre plates (Nunc) were coated for 18 h at 4°C with 50 µl of purified Amicwa or BSA at various concentrations (0.06, 0.25 and 0.6 µM), or of poly l-lysine at 10 µg ml−1 in 50 mM carbonate buffer (pH 9.6). Wells were treated for 2 h at 37°C with 200 µl well−1 of 0.5% BSA in PBS for blocking and washed three times with PBS. The adhesion assay was performed as follows. Wells were filled with 50 µl of a cell suspension (≈106 cells ml−1) in DMEM containing 0.4% BSA and incubated for 1 h at 37°C in a 10% CO2 atmosphere. Wells were then washed gently by immersing the plates three times in PBS. Bound cells were quantified by the hexosaminidase assay (Landegren, 1984). Values are given relative to the cell binding obtained with poly l-lysine-coated wells, fixed arbitrarily at 100. Specific pathogen-free female Swiss mice (Janvier) were used when they were 6–8 weeks old. The challenge inoculum was prepared from 18 h cultures in BHI broth. Bacteria were pelleted by centrifugation, washed once and diluted appropriately in 0.15 M NaCl. The virulence of Listeria strains was estimated by determining intravenous LD50 by the probit method. Groups of four mice were challenged intravenously with various doses of bacteria, and mortality was observed for 3 weeks. Bacterial growth in liver and spleen after intravenous challenge was studied as described previously (Gaillard etal., 1996). Student\'s t-test was used, and P-values of 0.05 were considered statistically significant. We thank H. Bierne for kindly providing pAT28.a-5, and S. Nair, C. Tinsley and R. Hummel for help with the manuscript. E.M. and R.J. received financial support from the Ministère de l\'Education Nationale, de la Recherche et de la Technologie. This work was supported by the University Paris V, the Ministère de l\'Education Nationale, de la Recherche et de la Technologie, the EU (grant 659/RA03813), the Fondation pour la Recherche Médicale, GlaxoWellcome and SmithKline Beecham.Lopez-Mato, P. & Leyva-Cobian, F. (1997) Host cell heparan sulfate proteoglycans mediate attachment and entry of Listeria monocytogenes, and the listerial surface protein ActA is involved in heparan sulfate receptor recognition. Infect Immun 65: 78– 88. Baba, T. & Schneewind, O. (1998) Targeting of muralytic enzymes to the cell division site of Gram- positive bacteria: repeat domains direct autolysin to the equatorial surface ring of Staphylococcus aureus. EMBO J 17: 4639– 4646.DOI: 10.1093/emboj/17.16.4639 Wiley Online LibraryHansman, D. & Paton, J.C. (1989) Contribution of autolysin to virulence of Streptococcus pneumoniae. Infect Immun 57: 2324– 2330. Birnboim, H.C. & Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7: 1513– 1523.Smith, T.J. & Foster, S.J. (1998) The role of autolysins during vegetative growth of Bacillus subtilis 168. Microbiology 144: 73– 82.Lindahl, G. & Cossart, P. (1997) InlB: an invasion protein of Listeria monocytogenes with a novel type of surface association. Mol Microbiol 25: 285– 294. Wiley Online LibraryOhayon, H. & Cossart, P. (1998) The InIB protein of Listeria monocytogenes is sufficient to promote entry into mammalian cells. Mol Microbiol 27: 1077– 1087. Wiley Online LibraryAndrew, P.W. & Mitchell, T.J. (1995) The role of pneumolysin and autolysin in the pathology of pneumonia and septicemia in mice infected with a type 2 pneumococcus. J Infect Dis 172: 119– 123.Nichterlein, T. & Notermans, S. (1992) Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfA gene. J Bacteriol 174: 568– 574. Cossart, P. & Lecuit, M. (1998) Interactions of Listeria monocytogenes with mammalian cells during entry and actin-based movement: bacterial factors, cellular ligands and signaling. EMBO J 17: 3797– 3806.DOI: 10.1093/emboj/17.14.3797 Wiley Online LibraryLopez, R. & Garcia, J.L. (1992) Role of the major pneumococcal autolysin in the atypical response of a clinical isolate of Streptococcus pneumoniae. J Bacteriol 174: 5508– 5515.Dehoux, P. & Cossart, P. (1993) Common features of Gram-positive bacterial proteins involved in cell recognition. Mol Microbiol 9: 1119– 1122. Wiley Online LibraryMastroeni, P. & Cossart, P. (1995) Entry of Listeria monocytogenes into hepatocytes requires expression of InIB, a surface protein of the internalin multigene family. Mol Microbiol 16: 251– 261. Wiley Online LibraryBerche, P. & Gaillard, J.L. (2000) Optimization of green fluorescent protein expression vectors for in vitro and in vivo detection of Listeria monocytogenes. Res Microbiol 151: 1– 9. Gaillard, J.L. & Finlay, B.B. (1996) Effects of cell polarization and differentiation on entry of Listeria monocytogenes into the enterocyte-like Caco-2 cell line. Infect Immun 64: 1299– 1308.Richard, S. & Sansonetti, P.J. (1987) In vitro model of penetration and intracellular growth of Listeria monocytogenes in the human enterocyte-like cell line Caco-2. Infect Immun 55: 2822– 2829.Gouin, E. & Cossart, P. (1991) Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from Gram-positive cocci. Cell 65: 1127– 1141.Jaubert, F. & Berche, P. (1996) The inlAB locus mediates the entry of Listeria monocytogenes into hepatocytes in vivo. J Exp Med 183: 359– 369. Gatermann, S. & Meyer, H.G. (1994) Staphylococcus saprophyticus hemagglutinin binds fibronectin. Infect Immun 62: 4556– 4563.Meyer, H.G. & Wanner, G. (1992) Staphylococcus saprophyticus hemagglutinin is a 160-kilodalton surface polypeptide. Infect Immun 60: 4127– 4132.Berche, P. & Gaillard, J.L. (1997) Culture-negative listeriosis of the central nervous system diagnosed by detection of antibodies to listeriolysin O. Eur J Clin Microbiol Infect Dis 16: 176– 178.Perdreau-Remington, F. & Gotz, F. (1996) Characterization of Tn917 insertion mutants of Staphylococcus epidermidis affected in biofilm formation. Infect Immun 64: 277– 282.Peters, G. & Gotz, F. (1997) Evidence for autolysin-mediated primary attachment of Staphylococcus epidermidis to a polystyrene surface. Mol Microbiol 24: 1013– 1024. Wiley Online LibraryMeyer, H.G. & Gatermann, S.G. (1998) Cloning of aas, a gene encoding a Staphylococcus saprophyticus surface protein with adhesive and autolytic properties. Mol Microbiol 29: 871– 881. Wiley Online Library Ireton, K. & Cossart, P. (1997) Host–pathogen interactions during entry and actin-based movement of Listeria monocytogenes. Annu Rev Genet 31: 113– 138.Payrastre, B. & Cossart, P. (1999) The Listeria monocytogenes protein InlB is an agonist of mammalian phosphoinositide 3-kinase. J Biol Chem 274: 17025– 17032.Gounon, P. & Cossart, P. (1999) Interaction between the protein InlB of Listeria monocytogenes and lipoteichoic acid: a novel mechanism of protein association at the surface of Gram-positive bacteria. Mol Microbiol 34: 902– 914. Wiley Online Library Kuhn, M. & Goebel, W. (1989) Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells. Infect Immun 57: 55– 61.Funahashi, T. & Sekiguchi, J. (1992) Genetic structure, isolation and characterization of a Bacillus licheniformis cell wall hydrolase. Mol Gen Genet 234: 129– 137. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680– 685. Wiley Online Library Landegren, U. (1984) Measurement of cell numbers by means of the endogenous enzyme hexosaminidase. Applications to detection of lymphokines and cell surface antigens. J Immunol Methods 67: 379– 388. McLaughlan, A.M. & Foster, S.J. (1998) Molecular characterization of an autolytic amidase of Listeria monocytogenes EGD. Microbiology 144: 1359– 1367.Nadakavukaren, M.J. & Jayaswal, R.K. (1994) Autolysis-defective mutant of Staphylococcus aureus: pathological considerations, genetic mapping, and electron microscopic studies. Infect Immun 62: 1406– 1409.Mège, R.M. & Cossart, P. (1996) E-cadherin is the receptor for internalin, a surface protein required for entry of L. monocytogenes into epithelial cells. Cell 84: 923– 932.Berche, P. & Gaillard, J.-L. (2000) Identification of new loci involved in adhesion of Listeria monocytogenes to eukaryotic cells. Microbiology 146: 731– 739. Navarre, W.W. & Schneewind, O. (1999) Surface proteins of Gram-positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol Mol Biol Rev 63: 174– 229.Suginaka, H. & Tomasz, A. (1995) A Staphylococcus aureus autolysin that has an N-acetylmuramoyl-l-alanine amidase domain and an endo-beta-N-acetylglucosaminidase domain: cloning, sequence analysis, and characterization. Proc Natl Acad Sci USA 92: 285– 289.Sunki, G.R. & Bhunia, A.K. (1999) Surface protein p104 is involved in adhesion of Listeria monocytogenes to human intestinal cell line, Caco-2. J Med Microbiol 48: 117– 124.McLauchlin, J. & Courvalin, P. (1992) Genetic basis of tetracycline resistance in clinical isolates of Listeria monocytogenes. Antimicrob Agents Chemother 36: 463– 466.Ortqvist, A. & Masure, H.R. (1997) Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae. Mol Microbiol 25: 819– 829. Wiley Online LibraryFritsch, E.F. & Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Shockman, G.D. & Höltje, J.V. (1994) Microbial peptidoglycan (murein) hydrolases. In Bacterial Cell Wall. J.M. Ghuysen, and R. Hakenbeck (eds). Amsterdam: Elsevier Science, pp. 131– 166.De Rycke, J. & Dubray, G. (1992) Analysis of surface proteins of Listeria in relation to species, serovar and pathogenicity. J Gen Microbiol 138: 743– 753.Martin, P. & Courvalin, P. (1987) Plasmid transfer by conjugation from Escherichia coli to Gram-positive bacteria. FEMS Microbiol Lett 48: 289– 294.Poyart-Salmeron, C. & Courvalin, P. (1990) A pair of mobilizable shuttle vectors conferring resistance to spectinomycin for molecular cloning in Escherichia coli and in Gram-positive bacteria. Nucleic Acids Res 18: 4296.Varaldo, P.E. & Satta, G. (1991) Staphylococcal endo-beta-N-acetylglucosaminidase inhibits response of human lymphocytes to mitogens and interferes with production of antibodies in mice. J Clin Invest 87: 1969– 1976. Ward, J.B. & Williamson, R. (1984) Bacterial autolysins: specificity and function. In Microbial Cell Wall Synthesis and Autolysis. C. Nombela (ed.). Amsterdam: Elsevier Science Publishers, pp. 159– 166.Maroushek, N. & Czuprynski, C.J. (1993) Multiplication of Listeria monocytogenes in a murine hepatocyte cell line. Infect Immun 61: 3068– 3072.Gerike, U. & Goebel, W. (1993) The iap gene of Listeria monocytogenes is essential for cell viability, and its gene product, p60, has bacteriolytic activity. J Bacteriol 175: 3491– 3501. Wiley Online LibraryMatsumoto, A. & Suginaka, H. (1996) An autolysin ring associated with cell separation of Staphylococcus aureus. J Bacteriol 178: 1565– 1571.Vieira, J. & Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103– 119. Yother, J. & White, J.M. (1994) Novel surface attachment mechanism of the Streptococcus pneumoniae protein PspA. J Bacteriol 176: 2976– 2985. The full text of this article hosted at iucr.org is unavailable due to technical difficulties. Please check your email for instructions on resetting your password. If you do not receive an email within 10 minutes, your email address may not be registered, and you may need to create a new Wiley Online Library account. Can\'t sign in? Forgot your username? Enter your email address below and we will send you your username If the address matches an existing account you will receive an email with instructions to retrieve your username
