Mouse p27 PCR Using Gitschier Buffer

Mutant allele: Neo-1 primer (CCTTCTATCGCCTTCTTG), plus mgK-3 primer (TGGAACCCTGTGCCATCTCTAT) produce a 0.5kB PCR product.

Wildtype allele: mgK-3 (above) plus mcK-5 (GAGCAGACGCCCAAGAAGC) produce ~1kB product.

Stock Solutions:

1 M Tris pH 8.8 (do not use pH meter, store at room temp.)1.23 g Tris HCl5.13 g Tris baseq.s. 50 mL with H₂O

KG-1 (10x) (Store frozen)

Amt		[final]
8.3 mL	1M (NH4)2SO4	166mM
33.5 mL	1 M Tris base pH 8.8	670 mM
174 µL	ß-Mercaptoethanol	50 mM
3.35 mL	1M MgCl2	67 mM

q.s. to 50 mL with H2O and aliquot into 1.5 mL eppendorf tubes

KG-2 (10x) (Store frozen)25 µL of 100mM dNTP Stocks (x4) [@10 mM]25 µL DMSO 10%25 µL 8 mg/mL BSA [0.8 mg/mL]q.s. 100 µL H2O (makes 250 µL Total)

PCR Reaction Mix (To make a fresh master mix, multiply # PCR reactions x volumes, below)

2 µL KG-1 (10x) 1x2 µL KG-2 (10x) 1x2 µL Primer 1 (1uM) 0.1 mM2 µL Primer 2 (1uM) 0.1 mM0.2 µL Taq (Gibco) (5 U/uL) 0.05 U/mL10 µL H2O1.8 µL DNA20 µL Total

Cycling Parameters: It is important to not place the tubes on the machine until the block has heated to > 90ºC. The first 4 cycles employ a higher melting temperature which helps to denature genomic DNA. Subsequent cycles use a lower melt which is sufficient for PCR product and preserves enzyme function. Longer (2 min.) extension times should be used if products > 2 kb are being amplified.

95°C hold x 2 min. (while inserting tubes)(96°C x 30", 57°C x 30", 65°C x 1-2') x4(93°C x 30", 57°C x 30", 65°C x 1-2') x364°C hold