plasmid/10 6 cells. Conditioned medium was harvested 3, 6 and 9 days after transfection and used for AP enzyme activity and to determine the relative concentration of the soluble receptors. Binding of the receptor to an immobilized heparin-FGF complex was done as previously described (Gray et al., 1996). Briefly, 10µl bed volume heparin-sepharose was mixed 1:1 with sepharose CL6B and 100 ng FGF2, FGF4 or FGF8. After adding PBS to 50 ml, the mixtures were rotated at room temperature for 1 hour, then washed twice with 100 µl PBS before the addition of receptor supernatant (800 mOD/minute). Following the addition of receptor supernatant, the mixtures were further incubated at room temperature for 4 hours, then washed three times with 200 µl 20 mM Hepes pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol, and twice with 150 µl 10 mM Tris pH 7.5, 0.5 M NaCl. The receptor-FGF-heparin sepharose complex was transferred in 60 µl 10 mM Tris pH 7.5, to a well of a microtiter plate containing 60 µl of 2« AP assay buffer (2 M diethanolamine, 1 mM MgCl2, 20 mM homoarginine, 12 mM p-nitrophenyl phosphate pH 9.5). The bound receptor was quantified by measuring the initial rate of substrate hydrolysis at 405 nm and same amount of proteins was used in the binding assays. Gray, T. E., Eisenstein, M., Yayon, A. and Givol, D. (1996). Asparagine-344 Is a Key Residue For Ligand Binding In Keratinocyte Growth Factor Receptor. Biochemistry 35, 15640-15645. PCR Assay for FGFR3 -/- Matings Oligos...5' oligo (JC 14): 5'-GGG CTC CTT ATT GGA CTC GC-3'3' oligo wild-type allele (JC 41): 5'-AGG TAT AGT TGC CAC GAT CGG AGG G-3'3' oligo knockout allele (JC 18): 5'- TGC TAA AGC GCA TGC TCC AGA CTG C-3' Fragment lengths...wild-type fragment (JC14/JC41): 322 bpknockout fragment (JC14/JC18): 221 bp PCR Conditions...Boehringer Mannheim Taq Polymerase and 10X PCR buffer.PCR program: 95¡C X 3'; 30 X (95¡C X 1', 55¡C X 1', 72¡C X 3');72¡C X 3' PCR for FGF9 KO miceOligos...5’ oligo: (JC46): 5’-GCA AGG GAG GGG AGT TGG ATA TAC C-3’3’ oligo: (JC42): 5’-CAG CCC AAG CTT TCG CGA GCT CG-3’ (in polII-neo)3’ oligo: (JC48): 5’-GAA ATC CAG TCC TGC AGT ACA GCT GC-3’PCR Conditions...Boehringer Mannheim Taq Polymerase and 10X BM PCR buffer with DMSO.PCR program: 95 C x 3’; 30 x (95 C x 1’ 55 C x 1’ 72 C x 3’); 72 C x 3’Product Size...wild type: 310 bpTargetted allele: 185 bp PCR for FGF17 KO miceNo PCR available for F17 ko genotyping. PCR assay for hGH (colII-FGFR3 mice)Oligos...5’ oligo: 5’AGGTGGCCTTTGACACCTACCAGG3’ 3’ oligo: 5’TCTGTTGTGTTTCCTCCCTGTTGG3’ Amplify 360 bp of hGH sequence present in 3’ UTR of the transgene. PCR amplification conditions...27 cycles of 94°C x 60 seconds, 55°C x 60 seconds and 72°C x 90 seconds.