96well RNA In Situ Hybridization Protocol

1. Materials

1.1. Probe Preparation

1.1.1. Cell Inoculation

1. 96-well, deep square-well round bottom plate (E&K Scientific Ritter Riplate).

2. Super Broth (SB: 10 gm 4-Morpholinepropanesulfonic acid (MOPS), 20 gm Bacto Yeast Extract, 30 gm Tryptone Peptone/L).

3. Antibiotic (80 µg/ml final concentration Carbenicillin- for pFLC-I or pBS SK, 80 µg/ml chloramphenicol for pOT2 or pOTB7).

4. Multichannel pipette (Brand).

5. Multichannel pipette (Qiagen Multi Electrapette 1550).

6. Airpore Tape Sheets (Qiagen).

7. Speedball roller (E&K Scientific).

8. Incubator/Shaker (Innova 4300).

1.1.2. PCR

1. 96-well semi-skirt PCR plate (E&K Scientific).

2. Deoxynucleotides (Promega, store at -20°C).

3. Sequence specific primers ( Invitrogen, store at -20°C).

pFLC-I vector:

M13 (-21) 5' TGTAAAACGACGGCCAGT 3'

M13 (REV) 5' GGAAACAGCTATGACCATG 3'

p0T2a vector:

PM001a 5' GTCGACGTTAGAACGCGGCTAC 3'

PM002a 5' GGGTTAAATTCCCGGGTACTGC 3'

pBS vector:

SK-30 5' GGGTAACGCCAGGGTTTTCC 3'

SKMet 5' ATGACCATGATTACGCCAAGC 3'

4. DNA Polymerase (DyNAzyme EXT DNA Polymerase-MJ Research, store at -20°C).

5. Inoculated cells (can be stored for up to 7 days at 4 ° C).

6. Multichannel pipette (Brand).

7. GeneAmp PCR System 9700 (Applied Biosystems).

8. Speedball roller (E&K Scientific).

9. Aluminum plate sealers (Polarseal:Foil adhesive Tape for multiwell plates T592100) (E&K Scientific) or 8-strip PCR caps (E&K Scientific).

1.1.3. PCR Product Purification (G-50 column chromatography)

1. Sephadex ™G-50 Superfine (Amersham Pharmacia Biotech).

2. MultiScreen column loader-45 µl (Milliore) MAHV N45 filter plate (Millipore).

3. MultiScreen Centrifuge Alignment Frame (Millipore).

4. Multichannel pipette (Brand).

5. Sterile 0.1% diethyl pyrocarbonate (DEPC, Sigma, handle carefully, toxic) treated H20 (autoclaved).

6. Eppendorf Centrifuge 5810 (equipped with 96-well plate holders).

7. 96-well semi-skirt PCR plate (E&K Scientific).

9. Aluminum plate sealers or 8-strip PCR caps (E&K Scientific).

1.1.4. RNA Probe Preparation

1. 96-well semi-skirt PCR plate (E&K Scientific).

2. Multichannel pipette (Brand).

3. Speedball roller (E&K Scientific).

4. GeneAmp PCR System 9700 (Applied Biosystems).

5. Aluminum plate sealers or 8-strip PCR caps (E&K Scientific).

6. Eppendorf Centrifuge 5810 (equipped with 96-well plate holders).

7. 2X Polymerase mix (2U [T7, T3, Sp6] RNA polymerase (Roche, store at -20°C), 4.6U RNase inhibitor (Amersham Parmacia Biotech), 10mM NTPs (Roche, store at -20°C), 3.5mM digoxigenin-11-UTP (Roche, store at -20°C), 40mM Tris pH 8.0, 6mM MgCl2, 10mM DTT and 2mM spermidine).

8. DEPC treated H20 (2.1.3.5).

9. 0.2 M Tris pH 8 (Dissolve 121.1 gms Tris-base in water, adjust pH with concentrated HCl; pH of Tris is temperature sensitive, sterilize by autoclaving).

10. 10X DNaseI Buffer (0.2 M Tris pH 8, 0.1 M MgCl2.

11. DNaseI mix (1U DNaseI (Amersham Pharmacia Biotech) (RNase-free, store at -20°C), 20 mM Tris pH 8, 10 mM MgCl2,, 10mm DTT).

12. 1 M Dithiothreitol (DTT) (Sigma) (Dissolve 3.09 g of DTT in 20 ml of 0.01 M sodium acetate pH 5.2, sterilize by filtration, aliquot and store at -20°C).

13. 0.2M Na2CO3 pH 10.2

14. 7.5M NH4OAC.

15. Absolute ethanol.

16. Resuspension buffer (50% formamide, 5mM Tris-HCl pH 7.5, 0.5mM EDTA and 0.01% Tween 20).

17. Formamide (Sigma).

18. TE pH 7.5 (10 mM Tris-HCl pH 7.5, 1 mM EDTA).

19. Tween 20 (polyoxyethykenesorbitan monolaurate) (Sigma).

20. Aluminum plate sealers or 8-strip PCR caps (E&K Scientific).

1.1.5. RNA Probe Quantificaton

1. DIG Quantification Teststrips (Roche).

2. DIG Control Teststrips (Roche).

3. 300 µl/well 96-well plate (E&K Scientific).

4. Multichannel pipette (Brand).

5. Falcon Pipetaid.

6. Aluminum plate sealers or 8-strip PCR caps (E&K Scientific).

7. Positively charged Nylon membrane (Roche).

8. UV Stratlinker (Stratagene).

9. HybAid tubes (HybAid Limited).

10. HybAid Hybridization oven (HybAid Limited).

11. 1X blocking solution (Dissolve 10 g of blocking reagent (Roche) in 0.1M maleic acid, 0.15M NaCl adjust pH to 7.5 with NaOH (solid), store at 4 ° C).

12. Tween 20 (polyoxyethykenesorbitan monolaurate, Sigma).

13. Anti-Digoxigenin-AP Fab Fragments (Roche).

14. AP Buffer (0.1M NaCl, 0.05M MgCl2, 0.1M Tris pH 9.5, 0.1% Tween 20; prepare fresh before use).

15. Developing solution (Roche, 45 µl NBT and 35 µl BCIP, store at -20°C) per 10 ml of AP Buffer; add NBT/BCIP just before use).

1.2. 96- well Plate RNA in situ Hybridization

1.2.1. Embryo Collection

1. Foam Trays (Xpedex).

2. Fly Food1 (3500 ml H2O, 125 g Agar, 125 g Sucrose, 8 g p-Hydroxybenzoic Acid Methyl Ester, 1360 ml Grape Juice, 100 ml 1.25 N NaOH).

3. Yeast (Fleishman) - Mix yeast with H20 to form a thick paste.

1.2.2. Embryo Fixation

1. Three-level sieve (nominal sieve openings (850 µm (20), 250 µm (60), 150µm (100)) (Fisher).

2. Falcon Pipetaid.

3. Paint brush (Winsor & Newton).

4. Crystallization dish (Fisher).

5. 100% sodium hypochlorite (commercial bleach, Kem Tek).

6. Gyrotory¨ shaker Model G2 (New Brunswick).

7. Heptane (Fisher).

8. Formaldehyde (Sigma, ACS reagent grade, 25 ml aliquots).

9. DEPC treated H20 (2.1.3.5).

10. PBS (Dissolve 8 g of NaCl, 0.2 g KCl, 0.24 g KH2PO4 and 2.72 g Na2HPO4 ·7H20 in 800 ml of DEPC treated H20, adjust pH to 7.4 with HCl, adjust volume to 1L, sterilize by autoclaving).

11. Methanol (EM Science).

1.2.3. 96- well Plate RNA in situ Hybridization

1. Master Embryo Mix (see section 3.2.3.1 note 26).

2. RNA Probe (see section 3.1.4).

3. Genetix Q-Fill 2 plate filler.

4. Millipore MAVM 096 01 vacuum manifold.

5. 300µ l/well 96-well plate (E&K Scientific).

6. Speedball roller (E&K Scientific).

7. Model 1545 Incubator (VWR).

8. Formaldehyde (Sigma).

9. DEPC treated H20 (2.1.3.5).

10. PBS (Dissolve 8 g of NaCl, 0.2 g KCl, 0.24 g KH2PO4 and 2.72 g Na2HPO4 ·7 H20 in 800 ml of DEPC treated H20, adjust pH to 7.4 with HCl, adjust volume to 1L, sterilize by autoclaving).

11. Tween 20 (polyoxyethykenesorbitan monolaurate, Sigma).

12. Methanol (EM Science).

13. PBT (0.1% Tween 20 in PBS).

14. 20X SSC (Dissolve 175.3 g NaCl and 88.2 g of Sodium Citrate in 800 ml of DEPC treated H20, adjust pH to 7, adjust volume to 1L, sterilize by autoclaving).

15. Hybridization buffer (50% formamide, 4X SSC, and 0.01% Tween 20, store in the dark at -20 °C).

16. Clay Adams¨ Brand Nutator.

17. 50% Dextran Sulfate (Dissolve 25 g of dextran sulfate in DEPC H20, adjust volume to 50 ml).

18. Hybridization Buffer with dextran sulfate, (50% formamide, 4X SSC, 5%dextran sulfate and 0.01% Tween 20 store in the dark at -20 °C).

19. Gyrotory¨ shaker Model G2 (New Brunswick).

20. Wide opening pipete tips (Rainin).

21. 25 ml reagent reservoir (Matrix).

22. 96-well filter plate (Millipore MADV N65)

23. Wash buffer (50% formamide, 2X SSC and 0.01% Tween 20; prepare fresh before use).

24. Goat Serum (Roche, store at -20°C).

25. Anti-Digoxigenin-AP Fab Fragments (store at 4 ° C) (Roche).

26. AP Buffer (0.1M NaCl, 0.05M MgCl2, 0.1M Tris pH 9.5, 0.1% Tween 20; prepare fresh before use).

27. Developing solution (Roche, 45 µl NBT and 35 µl BCIP, store at -20°C, per 10 ml of AP Buffer; add NBT/BCIP just before use).

28. Absolute ethanol.

29. 70% Glycerol (Sigma, 70:30 Glycerol:PBS, filter sterilize).